ID: 927523809_927523814

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 927523809 927523814
Species Human (GRCh38) Human (GRCh38)
Location 2:23719767-23719789 2:23719791-23719813
Sequence CCCACAGAAAGCATCACAAGTAC TAAAGGGAGAAATATCCCTGAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 5, 3: 28, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!