ID: 927526962_927526968

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 927526962 927526968
Species Human (GRCh38) Human (GRCh38)
Location 2:23752892-23752914 2:23752926-23752948
Sequence CCCTCCCTAAACTAGGCCTCTAG TCCACACTGAGATGTTTCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103} {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!