|
Left Crispr |
Right Crispr |
| Crispr ID |
927548916 |
927548925 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:23979659-23979681
|
2:23979690-23979712
|
| Sequence |
CCCCGTCTCAAGTGGTCCTCCTA |
TCCCAAATAGCTGGAACGATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 160, 3: 3686, 4: 35732} |
{0: 1, 1: 25, 2: 754, 3: 10896, 4: 83839} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|