ID: 927554497_927554501

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 927554497 927554501
Species Human (GRCh38) Human (GRCh38)
Location 2:24022558-24022580 2:24022593-24022615
Sequence CCTGAGCTGGGGACATGTGTGGT ACATATGGCCAGAGTTCTGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 19, 4: 219} {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!