ID: 927555652_927555655

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 927555652 927555655
Species Human (GRCh38) Human (GRCh38)
Location 2:24029646-24029668 2:24029661-24029683
Sequence CCCAGCTCCATCTTGGTAAACTG GTAAACTGTAACAGACAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166} {0: 1, 1: 0, 2: 2, 3: 8, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!