ID: 927555652_927555657

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 927555652 927555657
Species Human (GRCh38) Human (GRCh38)
Location 2:24029646-24029668 2:24029673-24029695
Sequence CCCAGCTCCATCTTGGTAAACTG AGACAGACAGGAGTCCCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166} {0: 1, 1: 0, 2: 1, 3: 21, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!