ID: 927607757_927607761

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 927607757 927607761
Species Human (GRCh38) Human (GRCh38)
Location 2:24503364-24503386 2:24503395-24503417
Sequence CCTTCCTCTGTCTTCTTAACAGT CACTAATTCCTCATGTATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 427} {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!