ID: 927615176_927615180

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 927615176 927615180
Species Human (GRCh38) Human (GRCh38)
Location 2:24586739-24586761 2:24586777-24586799
Sequence CCACCATGCCTGGCCAGCTTGCT TTTTCTACACATATGCAACTTGG
Strand - +
Off-target summary {0: 3, 1: 12, 2: 158, 3: 1255, 4: 7341} {0: 1, 1: 0, 2: 2, 3: 19, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!