ID: 927670896_927670906

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 927670896 927670906
Species Human (GRCh38) Human (GRCh38)
Location 2:25068046-25068068 2:25068086-25068108
Sequence CCTGCTTCCCTGTGCATACGAGC CATGGGCTTTCTGAGCCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 103} {0: 1, 1: 0, 2: 3, 3: 20, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!