ID: 927680052_927680061

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 927680052 927680061
Species Human (GRCh38) Human (GRCh38)
Location 2:25133053-25133075 2:25133081-25133103
Sequence CCCCCAGCTGCATTTTCTGACCC TTTATCCCTCTTAATTTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 254} {0: 1, 1: 0, 2: 4, 3: 45, 4: 533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!