ID: 927694577_927694596

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 927694577 927694596
Species Human (GRCh38) Human (GRCh38)
Location 2:25231192-25231214 2:25231243-25231265
Sequence CCTCCCCCAGCCCTCCTGGAGTG AGAGCCCCGCGGGAGCAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 597} {0: 1, 1: 0, 2: 1, 3: 12, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!