ID: 927694763_927694772

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 927694763 927694772
Species Human (GRCh38) Human (GRCh38)
Location 2:25232234-25232256 2:25232278-25232300
Sequence CCATCCCCCCTCCCATTATAAAA TATCTACACCCCATCTACCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 400} {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!