ID: 927695173_927695177

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 927695173 927695177
Species Human (GRCh38) Human (GRCh38)
Location 2:25235006-25235028 2:25235039-25235061
Sequence CCATTTGCATCAAATCAGGGTGT AGGTCTGCCTGGCCCTATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134} {0: 1, 1: 0, 2: 1, 3: 11, 4: 204}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
10 2:25235006-25235028 CCATTTGCATCAAATCAGGGTGT - 2:25235039-25235061 AGGTCTGCCTGGCCCTATGCTGG +