ID: 927698519_927698523

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 927698519 927698523
Species Human (GRCh38) Human (GRCh38)
Location 2:25252768-25252790 2:25252798-25252820
Sequence CCAAAAAAAAAAAAAGAAAAAGC TAGGAGGCCCAGGAAGCTGTAGG
Strand - +
Off-target summary {0: 2, 1: 323, 2: 2974, 3: 22170, 4: 32329} {0: 1, 1: 0, 2: 4, 3: 36, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!