ID: 927702227_927702239

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 927702227 927702239
Species Human (GRCh38) Human (GRCh38)
Location 2:25275905-25275927 2:25275935-25275957
Sequence CCAAAGGAGGAGCAGGAAGGCAG GCGGAAGGAGGAGGGGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 464} {0: 1, 1: 0, 2: 8, 3: 167, 4: 1980}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!