ID: 927712211_927712224

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 927712211 927712224
Species Human (GRCh38) Human (GRCh38)
Location 2:25332926-25332948 2:25332970-25332992
Sequence CCAGAACCCAGCAAAGGCCACTC CAGTGGGCAGGGAGGGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 204} {0: 1, 1: 0, 2: 13, 3: 167, 4: 1216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!