ID: 927713822_927713835

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 927713822 927713835
Species Human (GRCh38) Human (GRCh38)
Location 2:25340923-25340945 2:25340945-25340967
Sequence CCGCGGCCGCCCGGGCACCCACG GGCCCGCGGTGGGGACAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 302} {0: 1, 1: 0, 2: 4, 3: 53, 4: 515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!