ID: 927713875_927713895

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 927713875 927713895
Species Human (GRCh38) Human (GRCh38)
Location 2:25341059-25341081 2:25341098-25341120
Sequence CCCGGCCCCGCCGGCGCCCCGCA GCCGGAGGAGGATCGCGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 102, 4: 692} {0: 1, 1: 0, 2: 2, 3: 14, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!