ID: 927739129_927739134

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 927739129 927739134
Species Human (GRCh38) Human (GRCh38)
Location 2:25551467-25551489 2:25551502-25551524
Sequence CCGGCTGGGGATCCTTGGCTGAA GAGTTGGCTGAGCAGCTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128} {0: 1, 1: 0, 2: 1, 3: 13, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!