ID: 927740668_927740679

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 927740668 927740679
Species Human (GRCh38) Human (GRCh38)
Location 2:25566733-25566755 2:25566780-25566802
Sequence CCACCTGAAAGGGTTGCAGGGAA ATTTCAATGGAGACAGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 41, 4: 301} {0: 1, 1: 0, 2: 1, 3: 14, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!