ID: 927745068_927745075

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 927745068 927745075
Species Human (GRCh38) Human (GRCh38)
Location 2:25611525-25611547 2:25611555-25611577
Sequence CCATGGGTGTCTGAATCCACACA CTGCAGATACAGAGGGCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 30, 4: 275} {0: 2, 1: 0, 2: 7, 3: 22, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!