ID: 927750444_927750446

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 927750444 927750446
Species Human (GRCh38) Human (GRCh38)
Location 2:25664854-25664876 2:25664870-25664892
Sequence CCCATTTTCTTTCTATTGTGTCA TGTGTCACATCGCCCCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 5, 3: 74, 4: 701} {0: 1, 1: 0, 2: 0, 3: 5, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!