ID: 927751433_927751444

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 927751433 927751444
Species Human (GRCh38) Human (GRCh38)
Location 2:25673650-25673672 2:25673669-25673691
Sequence CCGGGGGCGTGGCTTCCGCGCGC GCGCGGGGAGGGGGCGGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94} {0: 1, 1: 4, 2: 33, 3: 460, 4: 4988}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!