ID: 927751433_927751448

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 927751433 927751448
Species Human (GRCh38) Human (GRCh38)
Location 2:25673650-25673672 2:25673701-25673723
Sequence CCGGGGGCGTGGCTTCCGCGCGC CCCCCTCCACCCCGCCCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94} {0: 1, 1: 1, 2: 14, 3: 155, 4: 897}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!