ID: 927783914_927783921

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 927783914 927783921
Species Human (GRCh38) Human (GRCh38)
Location 2:25959313-25959335 2:25959342-25959364
Sequence CCCCCTGTGAGCTCCCTCATGGC CATATCTTACTCATATCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 251} {0: 1, 1: 0, 2: 1, 3: 18, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!