ID: 927783917_927783925

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 927783917 927783925
Species Human (GRCh38) Human (GRCh38)
Location 2:25959316-25959338 2:25959367-25959389
Sequence CCTGTGAGCTCCCTCATGGCAGC CCTGGACTTAGCTCAGTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 241} {0: 1, 1: 0, 2: 4, 3: 44, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!