ID: 927783918_927783925

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 927783918 927783925
Species Human (GRCh38) Human (GRCh38)
Location 2:25959326-25959348 2:25959367-25959389
Sequence CCCTCATGGCAGCAGTCATATCT CCTGGACTTAGCTCAGTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156} {0: 1, 1: 0, 2: 4, 3: 44, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!