ID: 927783919_927783921

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 927783919 927783921
Species Human (GRCh38) Human (GRCh38)
Location 2:25959327-25959349 2:25959342-25959364
Sequence CCTCATGGCAGCAGTCATATCTT CATATCTTACTCATATCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 174} {0: 1, 1: 0, 2: 1, 3: 18, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!