ID: 927803832_927803835

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 927803832 927803835
Species Human (GRCh38) Human (GRCh38)
Location 2:26126907-26126929 2:26126928-26126950
Sequence CCTCCTTTAGGGAGGAAATAGTA TATTTGACATGGATATGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174} {0: 1, 1: 0, 2: 1, 3: 22, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!