ID: 927808926_927808929

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 927808926 927808929
Species Human (GRCh38) Human (GRCh38)
Location 2:26171487-26171509 2:26171505-26171527
Sequence CCCAGCTACATATGTAATTCCAG TCCAGCTACTCAGGAAGCTGAGG
Strand - +
Off-target summary No data {0: 296, 1: 10332, 2: 115707, 3: 217904, 4: 238356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!