ID: 927809817_927809820

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 927809817 927809820
Species Human (GRCh38) Human (GRCh38)
Location 2:26174602-26174624 2:26174628-26174650
Sequence CCAATAAAGATTATGGATTGAAT TGGGTGAGTGAATGAACAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 241} {0: 1, 1: 0, 2: 6, 3: 69, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!