ID: 927816397_927816402

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 927816397 927816402
Species Human (GRCh38) Human (GRCh38)
Location 2:26221349-26221371 2:26221376-26221398
Sequence CCTACCATCCTCTGTGAATAACT TCCTTTTGGGAAACAGTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 22, 4: 193} {0: 1, 1: 0, 2: 4, 3: 53, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!