ID: 927826345_927826353

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 927826345 927826353
Species Human (GRCh38) Human (GRCh38)
Location 2:26312397-26312419 2:26312423-26312445
Sequence CCCCTCCAGGTCTGCAAAGCTAG TGGTGACCAGCAGTGGTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 138} {0: 1, 1: 0, 2: 8, 3: 43, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!