ID: 927826644_927826650

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 927826644 927826650
Species Human (GRCh38) Human (GRCh38)
Location 2:26313950-26313972 2:26313999-26314021
Sequence CCTGGAACCCAGCAGGCTCTGAC CAGAAACAGAGGAAGCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 322} {0: 1, 1: 0, 2: 12, 3: 69, 4: 650}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!