ID: 927843176_927843184

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 927843176 927843184
Species Human (GRCh38) Human (GRCh38)
Location 2:26457894-26457916 2:26457922-26457944
Sequence CCCCGCAAGCAGGAGGCAGGCTC AAGGCATGAAGAGTGGACGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 162} {0: 1, 1: 1, 2: 2, 3: 37, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!