ID: 927846123_927846134

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 927846123 927846134
Species Human (GRCh38) Human (GRCh38)
Location 2:26473711-26473733 2:26473750-26473772
Sequence CCAGGAGAGCAGAGGAGGGGCAG AGGGTGGGGCTGCCCGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 136, 4: 921} {0: 1, 1: 0, 2: 4, 3: 44, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!