ID: 927846580_927846593

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 927846580 927846593
Species Human (GRCh38) Human (GRCh38)
Location 2:26475436-26475458 2:26475488-26475510
Sequence CCAGGTTGTCGAACACCAGCATC CAGCACCTGCAGCATGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66} {0: 1, 1: 0, 2: 4, 3: 23, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!