ID: 927869398_927869407

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 927869398 927869407
Species Human (GRCh38) Human (GRCh38)
Location 2:26614075-26614097 2:26614097-26614119
Sequence CCCCGGCCAGCTTGGCCAGCACC CTCATTAGGAGGCCCGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 268} {0: 1, 1: 0, 2: 0, 3: 1, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!