ID: 927872369_927872377

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 927872369 927872377
Species Human (GRCh38) Human (GRCh38)
Location 2:26631757-26631779 2:26631779-26631801
Sequence CCCTCTGGCTTAAGGGAAGCTCC CAGGAGGACTGGAGGTATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175} {0: 1, 1: 0, 2: 3, 3: 20, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!