ID: 927879193_927879198

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 927879193 927879198
Species Human (GRCh38) Human (GRCh38)
Location 2:26678754-26678776 2:26678767-26678789
Sequence CCCTGCAACTACCCTCCTCTTCT CTCCTCTTCTGTGCCATCAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 30, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!