ID: 927883974_927883976

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 927883974 927883976
Species Human (GRCh38) Human (GRCh38)
Location 2:26707232-26707254 2:26707252-26707274
Sequence CCGGACAGGGTCAGCTGCTCACG ACGGCTCCCACAGTAGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 141} {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!