ID: 927884466_927884477

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 927884466 927884477
Species Human (GRCh38) Human (GRCh38)
Location 2:26710091-26710113 2:26710119-26710141
Sequence CCTCCCACCCTGTCCTTGCGAGA CCGCACCCTCTGCCAAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 194} {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!