ID: 927885282_927885287

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 927885282 927885287
Species Human (GRCh38) Human (GRCh38)
Location 2:26714444-26714466 2:26714476-26714498
Sequence CCCTGGGACACAGTGCTTGGGGA CTCAGGCCCAACTGCTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 410} {0: 1, 1: 0, 2: 3, 3: 28, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!