ID: 927887546_927887554

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 927887546 927887554
Species Human (GRCh38) Human (GRCh38)
Location 2:26727944-26727966 2:26727980-26728002
Sequence CCAGGCCTACTACTACTGCTTCA CATCGGCTTCGGCGACTACGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 10, 4: 168} {0: 1, 1: 1, 2: 0, 3: 3, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!