ID: 927894846_927894860

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 927894846 927894860
Species Human (GRCh38) Human (GRCh38)
Location 2:26775136-26775158 2:26775174-26775196
Sequence CCCCCAGCAGCCCTTCAACCCTC CAGCGCTCTGTGACATGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 398} {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!