ID: 927929084_927929092

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 927929084 927929092
Species Human (GRCh38) Human (GRCh38)
Location 2:27032823-27032845 2:27032856-27032878
Sequence CCGCGGAAGCCTCTTCCCGATGC GGAGAGCCCGGCCCAGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97} {0: 1, 1: 0, 2: 1, 3: 41, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!