ID: 927945646_927945653

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 927945646 927945653
Species Human (GRCh38) Human (GRCh38)
Location 2:27133693-27133715 2:27133719-27133741
Sequence CCATTAATCAGCTCTAGCTGCAG GTGCTGTGGGAGGGGGAACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124} {0: 1, 1: 0, 2: 4, 3: 63, 4: 657}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!