ID: 927945646_927945656

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 927945646 927945656
Species Human (GRCh38) Human (GRCh38)
Location 2:27133693-27133715 2:27133736-27133758
Sequence CCATTAATCAGCTCTAGCTGCAG ACCCGGATGAGCAAGTTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124} {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!