ID: 927964006_927964015

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 927964006 927964015
Species Human (GRCh38) Human (GRCh38)
Location 2:27258049-27258071 2:27258090-27258112
Sequence CCCAGAGTCTCTGCGGGTGGGGG GACCTGCTTGGGACCCTGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144} {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!