ID: 927971341_927971356

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 927971341 927971356
Species Human (GRCh38) Human (GRCh38)
Location 2:27307747-27307769 2:27307782-27307804
Sequence CCGCCACCCTGGTTCCGTGCCCC CAGACTCGGGTCCTGGACCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 292} {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!